¿Cuáles eran los estamentos de la Edad Media?

Sociedad Ir a comentarios 60

La sociedad estamental fue una característica de la Edad Media europea que duró hasta la Revolución francesa, cuando nació la sociedad burguesa. El sistema del feudalismo trajo consigo un ordenamiento en el ámbito social, una división de la población en estamentos que aún permanece en la memoria.

En función de la posesión de privilegios, la sociedad estamental de la Edad Media se dividía en tres estractos: nobleza, clero y tercer estado.

El primer estamento era la Nobleza, que incluía a reyes, condes, duques y caballeros. El segundo estamento correspondía al Clero que, a su vez, se subdividía en alto y bajo. Los Papas, cardenales, obispos y abades pertenecían al alto, mientras que en el bajo se encontraban los párrocos y monjes, entre otros. El resto de las personas o pueblo llano, era parte del tercer estamento, que estaba formado por campesinos, villanos, artesanos y burgueses. Entre estos estamentos prácticamente no existía movilidad social, ya que la fijación se daba por nacimiento. La única manera de cambiar de estamento era a través del ingreso en la carrera eclesiástica.

La nobleza y el clero eran los estamentos privilegiados. Eran dueños de las tierras que el tercer estamento labraba, estaban exentos de pagar impuestos y cobraban un atributo a los campesinos libres o siervos que vivían en ellas.

60 opiniones en “¿Cuáles eran los estamentos de la Edad Media?”

  1. Anónimo dice:

    me sirbio mucho pero todabia no me ashuda porke cre0 ke el primer hestamento hera el rrey y despues nose kual i ezo ez lo ke keria zaver grasiaz xd dd dd dddddd d d ddd d d d dddddd d d dd.

  2. Anónimo dice:

    ME HA SERBIDO MUCHO

    2
    1
  3. Anónimo dice:

    gracias por su ayuda

  4. Anónimo dice:

    ME SERBIRA MUCHO EN MIS TAREAS

  5. Olakase dice:

    Holis

    1
    3
  6. tuhermana dice:

    es de buena ayuda para prueba bueno que trae informacion que no conosco pero es bueno

  7. maru dice:

    es muy bueno ahora me sirve , gracias me saque un 10 :p

  8. rocio dice:

    no es verdad eso

  9. no es eso verdad dice:

    el primer estamento no es eso es el rey

  10. i dice:

    xd

  11. alejandro cartagena dice:

    En que estamento pertenece vate????

  12. TuPico dice:

    Todas las Javieras son maracas, Y cabe la coincidencia de que me llamo Javiera y soy maraca…. Si lo vuelvo a publicar porque soy chora.

  13. tupico dice:

    <> Y cabe la coincidencia que me llamo Javiera, y por ende soy maraca

  14. Cristiano ronaldo dice:

    Boa informacao

  15. camilo hernandez dice:

    muy buena informacion me sirvio de mucha ayuda

  16. Schweinsteiger dice:

    Ahora lo entiendo mucho mejor…

  17. cucula dice:

    llevo dias buscado una pagina por fin lo encuentro

  18. maddie dice:

    no, era broma si me ayudo y bastante
    así que lo siento por lo de arriba
    haci que eso jajajajjajjaja

  19. Joel dice:

    Perfecto Gracias.

  20. dulce dice:

    necesito musha ayuda no entiendo historia

  21. alessa dice:

    Esta super completa la informacion y me intereso mucho este tema

  22. so dice:

    no entiendo nada, no lo lei, me da pepa, pero cuales son los estamentos alguien me puede decir qe tengo qe terminar el deber para mañanaaaa, gracias.

  23. ailen dice:

    increible esta pagina!!! .. graxias. encontre la respuesta a mi trabajo de historia facilmente y lo pude entenderr!!.. solo pido mas imagenes.. graxx agradesco al de la pagina.. um besho enorme
    :-*

  24. la maz edmosa del mundo dice:

    gracias me sak 10 en mi tarea los kiero

  25. leslie itzel dice:

    ESTA perfecto te lo agradesco a kien puso esta informacio :-*

  26. daniel dice:

    esta BUENISIMO al FIN podre hacer mi tarea

  27. esta bueno,porfin encontre lo que queria :D dice:

    aunque es mejor el face mejor hago primero la tarea.

  28. david dice:

    k aburridos es mejor el face

  29. lorenha dice:

    ke chiida iinfo0rmazZii0on

  30. Fersitha cardenas dice:

    graciiiiiiiiiaaaaaaaaaaas ya termiine my tarea y sak 10 mil graciias:)

  31. viki dice:

    necesito el estamento uno xfz

  32. dani perez dice:

    es muy interesante uuuuuuuu y gracias a esta informacion ya tengo mi tarea echa y tendre 10 de calificacion

  33. dani perz dice:

    es muy interesante uuuuuuuu

  34. stefanny dice:

    mmmm creo q esta mal no responde a mi pregunta

  35. kimberli dice:

    super bn sta bueno sencilllo era lo q buscaba

  36. milenita dice:

    no encuentro lo q buscaba 🙁

  37. carmen salazar ahumada dice:

    esta al 100%

  38. argelia abriz diaz dice:

    esta muy interesante e

  39. no pues esta bien esta explicacioon dice:

    tarea

  40. jonas caamaño mora dice:

    buenisimo , todo lo que uno necesita saber esta aqui!

  41. erik alberto quintana bueras dice:

    todo esta muy interesante y me gusto mucho gracias

  42. celenia cardenas garrobo dice:

    ps esta chido muy interante y nos sirvio mucho
    grasias

  43. yeleini alicia tellez felix dice:

    esta todo bien chido pero pongan mas informacion y mas dibujos pliiss

  44. EMANUEL HERNANDEZ MACHUCA dice:

    grasias por la imformacion pero no estaria mal que pusieras un poco mas de imformacion pero de todas maneras grasias

  45. mariana dice:

    Hola un libro o pagina para saber mas???

  46. andrea parro lopez dice:

    me gusta historia pero porque no ponen todos los estamentos….

  47. mariana dice:

    gracias la informacion que agregaste ..ayuda mas! por causalidad alguna pagina que me recomiendes o libro para entender este sistema de gobierno,mas que nada la transicion del feudal al estamental y del estamental al absolutismo….GRACIAS POR TU APORTE

    1. itafrvhymujdejpo dice:

      que interesante

      1
      1
  48. KENDRA VERNAL dice:

    error la sociedad estamental era un tipo de organización social que se dividía en tres partes la primera era llamada “primer estamento” en donde el único que ejercía el poder era el rey el cual era el unico que podía crear guerra y firmar la paz,
    la segunda parte era llamada “segundo estamento” en donde los que ejercían el poder era la nobleza y el alto credo que tenían un alto porcentaje de las tierras del rey
    y por ultimo en la tercera y ultima parte que era llamada “tercer estamento” los que ejercían su poder eran los burgueses, comerciantes, artesanos y campesinos y también en el tercer estamento los integrantes no tenían privilegio alguno y tenían que pagar muchos impuestos

    2
    1
    1. t dice:

      que interesante

      1
      2
    2. Anónimo dice:

      que interesante

    3. ITZEL dice:

      que interesante

      1
      1
  49. noe dice:

    estu tuvo bien x k si me sirbio

    1
    1
  50. mariana dice:

    GRACIAS bien sencillo…facil de comprender

  51. miguel dice:

    esta muy interesante

    1
    1
  52. yuridia dice:

    guaaaaaaaauuuuuuuuuu en esta pagina e encontrado cosas e increibles es l0 maximo

    1
    1
  53. ailyn dice:

    por que no ponen el segundo estamento 🙁

    1
    1
  54. nereyda dice:

    perfecto pero agregen mas imajenes pero se les agradece

    2
    1
  55. sofia dice:

    si hubiera mas paginas para esto yo estaria muy contenta pero no hay
    y a nosotros nos estan pidiendo una exposición para este lunes y aqui no hay nada de informacion
    por fa no la muelen y suban mas informacion gracias

    3
    1
  56. nathaly geraldine tinedo vinces dice:

    puxa en esta pagina encontrado todo lo q estaba buscando sobre este tema me ayudado muxo graxias

    1
    2

Deja un comentario

Tu dirección de correo electrónico no será publicada. Los campos obligatorios están marcados con *