¿Cuáles eran los estamentos de la Edad Media?

La sociedad estamental fue una característica de la Edad Media europea que duró hasta la Revolución francesa, cuando nació la sociedad burguesa. El sistema del feudalismo trajo consigo un ordenamiento en el ámbito social, una división de la población en estamentos que aún permanece en la memoria.

En función de la posesión de privilegios, la sociedad estamental de la Edad Media se dividía en tres estractos: nobleza, clero y tercer estado.

El primer estamento era la Nobleza, que incluía a reyes, condes, duques y caballeros. El segundo estamento correspondía al Clero que, a su vez, se subdividía en alto y bajo. Los Papas, cardenales, obispos y abades pertenecían al alto, mientras que en el bajo se encontraban los párrocos y monjes, entre otros. El resto de las personas o pueblo llano, era parte del tercer estamento, que estaba formado por campesinos, villanos, artesanos y burgueses. Entre estos estamentos prácticamente no existía movilidad social, ya que la fijación se daba por nacimiento. La única manera de cambiar de estamento era a través del ingreso en la carrera eclesiástica.

La nobleza y el clero eran los estamentos privilegiados. Eran dueños de las tierras que el tercer estamento labraba, estaban exentos de pagar impuestos y cobraban un atributo a los campesinos libres o siervos que vivían en ellas.


Comentarios (40)

nathaly geraldine tinedo vinces

marzo 15th, 2011 at 15:45 pm    


puxa en esta pagina encontrado todo lo q estaba buscando sobre este tema me ayudado muxo graxias

sofia

mayo 16th, 2011 at 23:17 pm    


si hubiera mas paginas para esto yo estaria muy contenta pero no hay
y a nosotros nos estan pidiendo una exposición para este lunes y aqui no hay nada de informacion
por fa no la muelen y suban mas informacion gracias

nereyda

octubre 29th, 2011 at 22:54 pm    


perfecto pero agregen mas imajenes pero se les agradece

ailyn

octubre 30th, 2011 at 1:39 am    


por que no ponen el segundo estamento :(

yuridia

noviembre 1st, 2011 at 17:57 pm    


guaaaaaaaauuuuuuuuuu en esta pagina e encontrado cosas e increibles es l0 maximo

miguel

noviembre 3rd, 2011 at 0:52 am    


esta muy interesante

mariana

noviembre 5th, 2011 at 19:32 pm    


GRACIAS bien sencillo…facil de comprender

noe

noviembre 8th, 2011 at 23:32 pm    


estu tuvo bien x k si me sirbio

KENDRA VERNAL

noviembre 9th, 2011 at 2:25 am    


error la sociedad estamental era un tipo de organización social que se dividía en tres partes la primera era llamada “primer estamento” en donde el único que ejercía el poder era el rey el cual era el unico que podía crear guerra y firmar la paz,
la segunda parte era llamada “segundo estamento” en donde los que ejercían el poder era la nobleza y el alto credo que tenían un alto porcentaje de las tierras del rey
y por ultimo en la tercera y ultima parte que era llamada “tercer estamento” los que ejercían su poder eran los burgueses, comerciantes, artesanos y campesinos y también en el tercer estamento los integrantes no tenían privilegio alguno y tenían que pagar muchos impuestos

mariana

noviembre 10th, 2011 at 21:37 pm    


gracias la informacion que agregaste ..ayuda mas! por causalidad alguna pagina que me recomiendes o libro para entender este sistema de gobierno,mas que nada la transicion del feudal al estamental y del estamental al absolutismo….GRACIAS POR TU APORTE

andrea parro lopez

noviembre 11th, 2011 at 2:36 am    


me gusta historia pero porque no ponen todos los estamentos….

mariana

noviembre 11th, 2011 at 16:52 pm    


Hola un libro o pagina para saber mas???

EMANUEL HERNANDEZ MACHUCA

noviembre 21st, 2011 at 23:39 pm    


grasias por la imformacion pero no estaria mal que pusieras un poco mas de imformacion pero de todas maneras grasias

yeleini alicia tellez felix

noviembre 22nd, 2011 at 18:13 pm    


esta todo bien chido pero pongan mas informacion y mas dibujos pliiss

celenia cardenas garrobo

noviembre 22nd, 2011 at 18:18 pm    


ps esta chido muy interante y nos sirvio mucho
grasias

erik alberto quintana bueras

noviembre 22nd, 2011 at 18:46 pm    


todo esta muy interesante y me gusto mucho gracias

jonas caamaño mora

noviembre 24th, 2011 at 16:51 pm    


buenisimo , todo lo que uno necesita saber esta aqui!

no pues esta bien esta explicacioon

diciembre 3rd, 2011 at 19:51 pm    


tarea

argelia abriz diaz

enero 12th, 2012 at 1:50 am    


esta muy interesante e

carmen salazar ahumada

febrero 2nd, 2012 at 1:58 am    


esta al 100%

milenita

agosto 21st, 2012 at 4:20 am    


no encuentro lo q buscaba :(

kimberli

octubre 3rd, 2012 at 17:47 pm    


super bn sta bueno sencilllo era lo q buscaba

stefanny

octubre 12th, 2012 at 23:54 pm    


mmmm creo q esta mal no responde a mi pregunta

dani perz

octubre 29th, 2012 at 7:23 am    


es muy interesante uuuuuuuu

dani perez

octubre 29th, 2012 at 7:25 am    


es muy interesante uuuuuuuu y gracias a esta informacion ya tengo mi tarea echa y tendre 10 de calificacion

viki

noviembre 6th, 2012 at 3:49 am    


necesito el estamento uno xfz

Fersitha cardenas

noviembre 8th, 2012 at 4:24 am    


graciiiiiiiiiaaaaaaaaaaas ya termiine my tarea y sak 10 mil graciias:)

lorenha

noviembre 13th, 2012 at 19:20 pm    


ke chiida iinfo0rmazZii0on

david

noviembre 13th, 2012 at 23:06 pm    


k aburridos es mejor el face

esta bueno,porfin encontre lo que queria :D

noviembre 17th, 2012 at 22:45 pm    


aunque es mejor el face mejor hago primero la tarea.

daniel

noviembre 27th, 2012 at 0:05 am    


esta BUENISIMO al FIN podre hacer mi tarea

leslie itzel

enero 16th, 2013 at 1:11 am    


ESTA perfecto te lo agradesco a kien puso esta informacio :-*

la maz edmosa del mundo

febrero 20th, 2013 at 21:56 pm    


gracias me sak 10 en mi tarea los kiero

ailen

abril 9th, 2013 at 21:58 pm    


increible esta pagina!!! .. graxias. encontre la respuesta a mi trabajo de historia facilmente y lo pude entenderr!!.. solo pido mas imagenes.. graxx agradesco al de la pagina.. um besho enorme
:-*

so

mayo 8th, 2013 at 19:50 pm    


no entiendo nada, no lo lei, me da pepa, pero cuales son los estamentos alguien me puede decir qe tengo qe terminar el deber para mañanaaaa, gracias.

alessa

noviembre 19th, 2013 at 6:08 am    


Esta super completa la informacion y me intereso mucho este tema

dulce

enero 22nd, 2014 at 3:27 am    


necesito musha ayuda no entiendo historia

Joel

febrero 18th, 2014 at 5:25 am    


Perfecto Gracias.

maddie

marzo 8th, 2014 at 19:46 pm    


no, era broma si me ayudo y bastante
así que lo siento por lo de arriba
haci que eso jajajajjajjaja

cucula

abril 3rd, 2014 at 15:37 pm    


llevo dias buscado una pagina por fin lo encuentro

Escribe tu comentario

Nombre *

Email (no será publicado) *

* Campos obligatorios

 

 



Saberia - Saber educativo © 2009-2014 Conteneo Networks, S.L.
Contacto | Contenidos educativos | Enlaces | Publicidad | Aviso Legal | Uso de Cookies
© Saberia / www.saberia.com - Saber educativo